sigG [2020-07-30 15:29:48]

RNA polymerase sporulation forespore-specific (late) sigma factor SigG

Locus: BSU_15330

Isoelectric point: 5.50

Molecular weight: 29.92 kDa

Protein length: 260 aa

Gene length: 783 bp

Function: transcription of sporulation genes (late forespore)

Product: RNA polymerase sporulation forespore-specific (late) sigma factor SigG

Essential: no

Synonyms: spoIIIG

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → RNA synthesis and degradation → Transcription → Sigma factors
• Information processing → Regulation of gene expression → Sigma factors and their control → Sigma factors
• Lifestyles → Sporulation → Sporulation proteins → Sporulation proteins/ other

Gene

Coordinates: 1,605,630 1,606,412

The protein

Protein family

• Sigma-70 factor family (according to UniProt)

Paralogous protein(s)

• SigF

Effectors of protein activity

• CsfB inhibits SigG activity PubMed
• the activity of SigG-containing RNA polymerase is modulated by YlyA PubMed

Structure

• 1L0O (SigF in complex with SpoIIAB, Geobacillus stearothermophilus, 47% identity) PubMed

Expression and Regulation

Operons

• Genes: spoIIGA-sigE-sigG
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon
  • SigG: sigma factor, PubMed, in SigG regulon
  • SigF: sigma factor, in SigF regulon

  Regulatory mechanism

  • SinR: repression, in SinR regulon
  • Spo0A: activation, PubMed, in Spo0A regulon
  • AbrB: repression, PubMed, in AbrB regulon

  Regulation

  • spoIIGA: expressed under conditions that trigger sporulation (Spo0A) PubMed

  Additional information

  • the mRNA half-life is about 2.6 min PubMed

• Genes: sigG
  Description: PubMed

  Regulation

  • spoIIGA: expressed under conditions that trigger sporulation (Spo0A) PubMed

  Additional information

  • the mRNA half-life is about 2.6 min PubMed
  • a conserved hairpin in the 5' leader sequence of the sigG mRNA occludes the ribosome-binding site, this reduces translation by up to 4-fold PubMed

Biological materials

Mutant

• BKE15330 (sigG::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACTTTTTTCCCTCCCTACA, downstream forward: _UP4_TAATGAAAAGCCTTTAAAAC
• BKK15330 (sigG::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACTTTTTTCCCTCCCTACA, downstream forward: _UP4_TAATGAAAAGCCTTTAAAAC

Labs working on this gene/protein

• Charles Moran, Emory University, NC, USA homepage

References

Reviews

Loading

The SigG regulon

Loading

Original Publications

Loading